Nić DNA na tle innych nici.

To nie pech, to złe geny

Czas czytania w minutach: 6

Pisałem tu już kiedyś o podstawach genetyki. Wyjaśniłem, że mamy po dwa “przepisy” na niemal wszystkie białka, które nasz organizm produkuje. Wspomniałem też, że znajomość naszych genów nie wystarcza, żeby wiedzieć dokładnie, jacy jesteśmy i jacy będziemy. “Przepis” na człowieka zawarty w DNA to jedna sprawa; jego realizacja to coś innego. Jak możemy się dowiedzieć, jakie dokładnie geny mamy? Jak poznać sekwencję DNA? I dlaczego napisałem, że mamy po dwa przepisy na niemal wszystkie białka? Pozwól, że wyjaśnię!

Genetyczna dyskryminacja

Zacznijmy może od drugiego pytania. Człowiek normalnie ma 23 pary chromosomów. 22 z nich są zupełnie przeciętne – dwa wyglądające tak samo chromosomy, jeden od mamy, jeden od taty. Nazywa się je autosomami. Ostatnia para jest nieco inna. Też należą do niej dwa chromosomy, nazywane allosomami, jeden od mamy, jeden od taty. Nie muszą one być identyczne. Każdy człowiek dostaje jeden duży chromosom X od mamy. Od taty może zaś dostać chromosom X, i wtedy urodzi się kobietą. Może też dostać mały chromosom Y, i urodzi się mężczyzną.

Istotna kwestia, która często umyka uwadze, to to, że ta ostatnia para chromosomów nie odpowiada tylko za płeć. Chromosom Y faktycznie zawiera geny odpowiedzialne tylko za około 70 białek, głównie związanych z płcią. Na chromosomie X znajduje się jednak również wiele innych genów, odpowiedzialnych między innymi za rozwój mózgu. Dlatego też nie ma możliwości przeżycia z dwoma chromosomami Y.

Niestety, oznacza to, że jeśli szkodliwa mutacja znajdzie się na chromosomie X, to mężczyzna z taką mutacją najprawdopodobniej nie będzie miał drugiej, “zdrowej” wersji genu na drugim chromosomie. Co za tym idzie, na choroby związane z mutacjami w obrębie genu X znacząco częściej zapadają mężczyźni – kobiety najczęściej są jedynie ich nosicielkami.

Choroba królów

Świetnym przykładem jest tutaj hemofilia, o której wielu słyszało – paradoksalnie – na lekcjach historii (oraz na naszym blogu, w artykule o aspirynie). Nosicielką genu hemofilii była brytyjska królowa Wiktoria. Przekazała go swojemu synowi, który zmarł na wylew w wieku 31 lat. Nosicielkami tego genu były też jej córki – Alicja i Beatrycze. Córki były zdrowe, ponieważ dysponowały również prawidłowymi kopiami genu na drugim chromosomie X – tym od ojca. Przekazały jednak swoje geny dalej, prowadząc do rozprzestrzenienia się hemofilii wśród europejskich rodzin królewskich – słynny carewicz Aleksiej był prawnukiem królowej Wiktorii.

Podobna historia dotyczy wczesnego łysienia. Mężczyzna nie przekaże genu łysienia swojemu synowi, ponieważ ten gen jest zlokalizowany na chromosomie X, a syn chromosom X dostanie od matki. Mężczyzna natomiast na pewno gen łysienia przekaże swojej córce, która będzie miała 50% szans na przekazanie go każdemu ze swoich dzieci (niezależnie). Jeśli przekaże go swojej córce, ta najpewniej będzie nosicielką. Dlaczego najprawdopodobniej? Ponieważ gen odpowiedzialny za łysienie jest recesywny; jeśli córka od swojej mamy dostanie dominującą wersję genu – sama nie wyłysieje. Jeśli chromosom ze zmutowanym genem zostanie przekazany synowi – ten wyłysieje…

Nie samym genem żyje człowiek

Ale pamiętajcie, proszę, że kwestie genów dominujących i recesywnych, a nawet geny przekazywane na chromosomie X, to nie jest jedyna przyczyna różnicy pomiędzy genotypem, czyli tym, co mamy zapisane w genach, a fenotypem, czyli tym, jak rzeczywiście wyglądamy i funkcjonujemy. Są, owszem, cechy kontrolowane przez pojedynczy gen. Jednak w wielu kwestiach geny mówią bardziej o naszym potencjale. To zaś, jak go zrealizujemy, zależy od konkretnych warunków, w jakich przyjdzie nam żyć.

Sztandarowym przykładem jest tutaj wzrost. Nie muszę Was chyba przekonywać, że wśród ludzi występują więcej niż dwa konkretne “wzrosty”? Widać więc wyraźnie, że jest tutaj coś więcej, niż tylko jeden gen. Naukowcy stwierdzili, że takich genów jest przeszło 180! Ale to wciąż nie wszystko. Nawet jeśli czyjeś geny w sumie predestynują go do wysokiego wzrostu, nie osiągnie go, jeśli będzie niedożywiony w dzieciństwie. Innym przykładem są tzw. “geny nowotworowe”. Jeśli nawet ktoś ma pecha odziedziczyć geny odpowiedzialne za powstawanie nowotworów, powinien pamiętać, że mówimy tutaj o zwiększonym prawdopodobieństwie, nie o pewności. Styl życia, dieta, ruch, czyste powietrze, kontakt z substancjami rakotwórczymi – te wszystkie czynniki wciąż mają spory wpływ na to, czy w jego fenotypie ostatecznie wystąpi choroba, czy też nie.

Nie zmienia to faktu, że wiedza o takich genach może być bardzo przydatna w medycynie. Przede wszystkim, jeśli wiadomo, że konkretna osoba jest bardziej podatna na jakiś konkretny rodzaj nowotworu, można do tej wiedzy dopasować profilaktykę, na przykład zalecić częstsze badania w tym konkretnym kierunku. Ma to kolosalne znaczenie, ponieważ – jak chyba wszyscy wiedzą z dziesiątek kampanii społecznych – nowotwór wcześnie wykryty jest dużo łatwiej wyleczalny. Ale to jeszcze nie wszystko! Informacja o konkretnych genach może też podpowiedzieć, na jakie leczenie dany nowotwór będzie bardziej wrażliwy. I na odwrót – może dać wskazówkę, które leki prawdopodobnie wywołają więcej skutków ubocznych u pacjenta.

Czytaj we mnie jak w książce

No dobrze, ale skąd można się dowiedzieć, jaki mamy kod genetyczny? Odczyt DNA, czyli jego sekwencjonowanie, jest dziś zajęciem rutynowym, choć niedawno jeszcze potrafiło zająć całe lata. Technicznie sekwencjonowanie polega na kopiowaniu fragmentów DNA. Załóżmy, że mamy krótki fragment kodu genetycznego, który chcemy odczytać. Pierwszym krokiem jest powielenie tego DNA – jedna czy nawet kilka cząsteczek to zdecydowanie za mało.

Tutaj pomocą staje się dla nas komplementarność DNA. Pamiętacie z poprzedniego artykułu, że DNA standardowo ma przy sobie kopię zapasową – dołączoną drugą, komplementarną nić, na podstawie której można skopiować pierwszą? No więc możemy to wykorzystać również w laboratorium. Wystarczy oddzielić od siebie dwie nici DNA. Najłatwiej to zrobić podnosząc temperaturę, zwykle do około 90 stopni. Później studzimy, dodajemy do próbki enzym zwany polimerazą. Enzym ten do syntezy DNA potrzebuje trzech rzeczy. Po pierwsze, nici DNA, która ma posłużyć za wzorzec. Po drugie, krótkiego kawałka komplementarnego DNA, przyłączonego do wzorca, tzw. primera. I po trzecie wreszcie – wolnych nukleotydów, które będzie mogła dołączać do primera, budując pełną nić komplementarną. Po jednym takim cyklu z jednej cząsteczki dwuniciowego DNA mamy dwie. Teraz wystarczy znowu je podgrzać…

I mamy problem. Pamiętacie może, że w artykule o enzymach pisałem coś na temat optymalnej temperatury ich funkcjonowania? No więc w temperaturze rzędu 90 stopni standardowo wtedy wykorzystywana polimeraza z bakterii E. coli nie tylko nie działała. Ona ulegała nieodwracalnym uszkodzeniom. Oznacza to, że po każdym cyklu ogrzewania i chłodzenia trzeba było dodawać kolejną porcję polimerazy.

Schemat reakcji łańcuchowej polimerazy.
Schemat reakcji PCR. Dwuniciowe DNA zostaje rozdzielone. Następnie do każdej nici przyłącza się primer, po czym następuje synteza. Powstają dwie cząsteczki dwuniciowego DNA, które znów zostają rozdzielone… I tak dalej.

Geny na gorąco

I tu właśnie pojawił się przebłysk geniuszu. Pamiętacie cytat z Jurrasic Park: “Life will find a way”? Nieważne, jak niegościnne jest środowisko, prawie na pewno da radę się w nim rozwinąć życie. Jakieś. Randy Saiki wpadł na pomysł: skoro bakterie Thermus aquaticus odkryto w gorących źródłach Yellowstone, to znaczy, że jego enzymy muszą wytrzymywać wysokie temperatury. I faktycznie: polimeraza wyizolowana z tych właśnie bakterii może być dodana na początku reakcji i bez problemu przetrzyma kolejne cykle podgrzewania i chłodzenia. I tak właśnie narodziła się metoda znana nam dziś jako PCR1Polymerase Chain Reaction – reakcja łańcuchowa polimerazy.

Mamy więc już namnożone DNA. Jak przejść do uzyskania jego sekwencji? Należy przeprowadzić reakcję PCR z jedną drobną modyfikacją: do mieszaniny dodaje się niewielką ilość zmodyfikowanych nukleotydów. Modyfikacja sprawia, że do takiego nukleotydu nie można już dołączyć kolejnego. Poza tym jest do niego dołączony barwnik fluorescencyjny. Tak zmodyfikowany nukleotyd może zostać losowo dołączony do łańcucha zamiast swojego niezmodyfikowanego odpowiednika. Ponieważ jest to losowe, i ponieważ ma miejsce wiele razy, dostaje się wiele nici DNA o różnej długości – przy czym każda nić ma przyłączoną cząsteczkę znacznika o barwie odpowiadającej ostatniemu nukleotydowi. Pozostaje tylko rozdzielić je ze względu na długość2Jak to działa – to temat na osobną dyskusję, dziś napiszę tylko, że do rozdziału służy elektroforeza – mieszaninę DNA umieszcza się na żelu lub w kapilarze, a następnie poddaje działaniu pola elektrycznego – i voila, odczytujemy sekwencję DNA litera po literze.

Genetyczne puzzle

No dobrze, wyjaśniłem, jak odczytać krótki kawałek DNA, ale co jeśli chcemy poznać dłuższy fragment? A nawet cały kod? No cóż, trzeba go przede wszystkim podzielić na kawałki, które następnie odczytuje się niezależnie. Dostaje się więc wiele fragmentów kodu genetycznego. Ale jak ustawić je we właściwej kolejności? Trik polega na tym, jak się DNA dzieli na kawałki. Wykorzystuje się do tego enzymy. Liczba mnoga jest celowa – wykorzystuje się różne enzymy, tak, żeby dostać kilka niezależnych sposobów podziału. Dzięki temu każde miejsce zostanie odczytane kilka razy. To sprawia, że możemy rozszyfrować całą sekwencję, patrząc na pokrywające się fragmenty. Żeby dokładniej wyjaśnić, co mam na myśli, pokażę Wam zbliżony przykład. Napisałem krótkie zdanie, usunąłem z niego spacje i znaki interpunkcyjne, a następnie pociąłem je dwa razy: raz enzymem, który tnie po literze “L”, raz takim, który tnie po literze “O”. Tak wygląda wynik pierwszego cięcia:

OGPOPUL UBIONYBL POZWÓL ARNONAUKOWY ŻEWYJAŚNIĘTOMÓJUL

Dzięki temu, że jest to zdanie, już na tym etapie jesteście pewnie w stanie ułożyć je w odpowiedniej kolejności. Ale jednoznacznie to określić będziecie mogli, gdy zobaczycie wynik drugiego cięcia:

PO GPO NYBLO WY MÓJULUBIO ZWÓLŻEWYJAŚNIĘTO NAUKO PULARNO 

Ponieważ nasze zdanie zostało pocięte dwoma różnymi enzymami, wiemy, że miejsce, które w pierwszym zostało przecięte, w drugim będzie całe – i odwrotnie. To sprawia, że możemy całe zdanie przeczytać. I tak właśnie wygląda składanie w całość fragmentów sekwencjonowanego kodu DNA, tyle że zamiast:

POZWÓLŻEWYJAŚNIĘTOMÓJULUBIONYBLOGPOPULARNONAUKOWY3Jeśli to prawda, nie zapomnij wejść tutaj i polubić nas na Facebooku! :)

technik zobaczy na ekranie komputera:

AAATTATGCCTAATCCCTGGTGGGG…

I tak kawałek po kawałku, chromosom po chromosomie można dojść do pełnego odczytu genomu. Co ciekawe, dziś sam odczyt kolejnych fragmentów kodu genetycznego trwa krócej niż złożenie ich później w jedną całość i poprawienie ewentualnych błędów odczytu. Jeśli kogoś z Was taka usługa interesuje, i macie akurat wolne kilka tysięcy złotych, możecie poszukać w Google – są firmy, które chętnie podadzą Wam sekwencję Waszych łańcuchów DNA.

I w ten sposób możecie się dowiedzieć, jakimi mutantami jesteście. Bo że jesteście – to nie ulega żadnej wątpliwości. Ale skąd się biorą mutacje, jakie mają znaczenie i dlaczego niektóre są eliminowane, podczas gdy inne trwają z nami od pokoleń? O tym w następnym odcinku!

Źródła:

https://medlineplus.gov/genetics/understanding/traits/height/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2955183/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4786343/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3076508/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4251363/

https://www.cancer.org/cancer/cancer-causes/genetics/genes-and-cancer/genes-in-cancer-diagnosis-and-treatment.html

http://www.genomenewsnetwork.org/resources/whats_a_genome/Chp2_2.shtml

https://blog.labtag.com/a-brief-history-of-pcr-and-its-derivatives/



0 0 votes
Oceń artykuł
Powiadom mnie!
Powiadom o
guest
0 komentarzy
Inline Feedbacks
View all comments